Multiple Choice Questions - 201-300

 

Key Code: M

Use the agarose gel photograph below to answer questions

 

In the gel photograph shown, DNA was purified from several isolates of Staphylococcus aureus during an epidemic of infections at a local hospital. DNA was digested with SmaI and then run on the gel shown. Lanes 1, 12 & 13 carry marker DNAs. Lanes 2-7 carry DNA from isolates in the hospital nursery. Lanes 8-11 carry DNA from isolates in the hospital ICU.

The electrophoretic typing procedure pictured above is designed to identify similarities and differences among bacteria of the same species in order to divide them into different strains or electrophoretic types. Any differences seen among the lanes in the gel pictured above can best be ascribed to:

A) differential gene expression
B) antigenic variation
C) differing bacteriophage sensitivities
D) culture contamination
E) DNA sequence differences

Answer: E

(Year Posted: UI 201)

 

Key Code: M

Which of the following most accurately describes how extended-spectrum b-lactamases (ESBLs) originate?

A) induction of normal chromosomal genes
B) mutation of ordinary b-lactamase genes
C) treatment with aminoglycosides
D) treatment with extended-spectrum b-lactam antibiotics
E) treatment with ordinary b-lactam antibiotics

Answer: B

(Year Posted: UI 202)

 

Key Code: M

A mutant of E. coli was isolated that has a mutation in the gene coding the lac operon repressor protein. A mutant unable to synthesize this protein would

A) transport lactose, but not digest it
B) express lac operon genes all the time, whether or not lactose was present
C) be incapable of lac operon expression
D) be unable to survive in environments that contain lactose
E) be unable to survive in environments that did not contain lactose

Answer: B

(Year Posted: UI 203)

 

Key Code: M

Bacterial cells are not killed by their own restriction enzymes. Which of the following is the most accurate statement as to why this is so?

A) The cell's DNA is modified, usually via methylation patterns, to not be recognized by the restriction enzyme
B) The restriction enzyme is secreted to the outside away from the cellular DNA
C) The restriction enzyme is compartmentalized in vacuoles away from the cellular DNA
D) The cell wall cross-linking density is increased to protect the wall's integrity
E) The bacterial cell's DNA always lacks the recognition sequence required for DNA cutting by the restriction enzyme

Answer: A

(Year Posted: UI 204)

 

Key Code: M

Use the description below to answer questions

Two strains of Streptococcus pneumoniae were isolated from a sputum sample of a patient with bacterial pneumonia. One strain produced copious amounts of capsular material and the other strain did not produce a capsule. Genetic study of the two strains revealed that the acapsular strain had a mutation in a gene for a key enzyme required for capsule synthesis. The relevant regions of the DNA sequence of the two genes are shown:

                    Capsule          AATCGCGTAGCTAGCTTGACCGA

                    No capsule      AATCGCGTAGCAATAGCTTGACCGA 

The mutation in the acapsular strain's gene is best described as a:

A) missense mutation
B) nonsense mutation
C) frameshift mutation
D) inversion
E) deletion
F) transposition

Answer: C

Which of the following statements best describes the likely result of the mutation on the translation of the mRNA for the enzyme encoded by this gene?

A) One or two incorrect amino acids will be inserted into the protein
B) From the point of base insertion, total mistranslation will occur
C) mRNA translation will produce the same protein in both mutant and non-mutant strains
D) One or two amino acids will be omitted from the translation of the mutant mRNA resulting in a slightly truncated protein

Answer: B


DNA isolated from killed cells that can produce capsule is able to transform acapsular strains into capsule producing strains. Which of the following cellular processes will be required for this genetic change to be permanent?

A) transduction
B) adaptation
C) recombination
D) mutation
E) conjugation

Answer: C

(Year Posted: UI 205)

 

Key Code: M

Sulfa drugs are competitive inhibitors of dihydropteroate synthetase. Which of the following statements is most accurate?

A) Addition of large amounts of para-amino benzoic acid (PABA) will overcome the action of sulfa drugs
B) Sulfa drugs bind to a site on  the enzyme distant from  the active site
C) PABA binds to a different site on the enzyme than sulfa drugs
D) The ability to overcome the addition of sulfa drugs is due to irreversible binding to the enzyme active site
E) Sulfa drug binding to the enzyme makes the binding of trimethoprim more cooperative

Answer: A

(Year Posted:UI 206)

 

Key Code: M

A strain of bacteria was inoculated on a Kligler Iron Agar slant. After overnight incubation, the tube was entirely yellow and there were numerous bubbles noted inside the agar of the tube. Which of the following descriptions most accurately describes these observations?

A) Lac+ ,H2S+
B) Lac+, H2S-
C) Lac+, H2S-, mixed acid endproducts + gas
D) Lac+, H2S-, neutral endproducts + gas
E) Lac-, H2S-, Glu+, mixed acid endproducts + gas

Answer: C

 

Regarding the above question, which of the following bacteria would be most likely to produce a Kligler Iron Agar slant with this description?

A) Proteus mirabilis
B) Staphylococcus aureus
C) Staphylococcus epidermidis
D) Salmonella typhimurium
E) Pseudomonas aeruginosa
F) Escherichia coli

Answer: F

(Year Posted: UI 207)

 

Key Code: M

Pathogenicity islands have been defined as groups of related genes, often involved in virulence, found in different bacterial strains and species.  These "islands" can be located at widely different positions on the chromosomes of the different bacterial types or extrachromosomal DNA like plasmids.  Which of the following best describes the acquisition of pathogenicity islands by different bacteria?

A) random mutation
B) directed mutation
C) horizontal gene transfer
D) vertical gene transfer

Answer: C

 

Amino acid variability among the proteins encoded by related genes from pathogenicity islands located in different bacterial strains and species can best be accounted for by

A) random mutation
B) directed mutation
C) horizontal gene transfer
D) vertical gene transfer

Answer: A

(Year Posted: UI 208)

 

Key Code: M

Use the graph of bacterial growth below to answer questions:

 

In the environment, bacteria have often evolved to grow under a variety of different conditions.  For instance, many medically important bacteria such as the Enterobacteriaceae are facultative anaerobes.  Two cultures of a prototrophic Escherichia coli strain were begun at the same time in the same media.  One culture was grown aerobically and the other was grown anaerobically. Which of the lines above likely represents the anaerobically grown culture?

A) Line A
B) Line B
C) Line C

Answer: B

Regarding the measurement of cell numbers for the curves, the most accurate method to determine the number of viable bacteria present at each time point is,

A) measurements of turbidity relative to a culture with a known cell number
B) counting the cells by FACS analysis
C) analysis of the number of colony forming units
D) counting of cells by microscopy
E) measurements of the incorporation of radioactive precursors

Answer: C

An auxotrophic mutant of E. coli which requires histidine is grown in minimal media without the amino acid. Which of the growth curves above likely represents the growth of this culture?

A) Line A
B) Line B
C) Line C
D) counting of cells by microscopy
E) measurements of the incorporation of radioactive precursors

Answer: C

(Year Posted: UI 209)

 

Key Code: M

Use the graph of bacterial growth below to answer questions:

 

The bacterial death curves above were generated by measuring bacterial cell numbers after exposure of bacterial cultures to a disinfectant over periods of time. Curve X represents treatment of a culture of Staphylococcus aureus to disinfectant P at a concentration of 1 part per million.  Curve Y is the same bacteria, but the concentration of disinfectant was 2 parts per million. To achieve the same degree of killing seen with exposure to 2 parts per million of disinfectant P, the culture exposed to 1 part per million must be incubated for how many times longer?

A) 500
B) 250
C) 100
D) 50
E) 10
F) 5
G) 2
H) 1

Answer: F

 

Similar measurements of bacterial death at a disinfectant P concentration of 0.5 parts per million would result in

A) a death line with a shallower slope than either line X or line Y
B) a death line with a steeper slope than either line X or Line Y
C) no change from curve X
D) no change from curve Y
E) curve Z

Answer: A

 

Curve Z represents the effect of disinfectant P at 1 part per million on a mixed population of S. aureus and Escherichia coli.  Which of the following statements is the most likely explanation for the biphasic nature of curve Z?

A) Toxic waste products from one of the species resulted in the more rapid inactivation of the other species
B) A disinfectant P resistant population emerged as a result of mutation
C) One of the species is more resistant than the other to disinfectant P
D) A disinfectant P resistant population emerged as a result of genetic exchange between the two species
E) The presence of the E. coli masked the killing of the S. aureus

Answer: C

(Year Posted: UI 210)

 

Key Code: M

Use the figure below to answer questions,

 

Multiplex PCR analyses use multiple sets of primers to simultaneously amplify different genetic regions in tested samples. The ethidium bromide-stained agarose gel photograph above shows an assay designed to identify species of Staphylococcus aureus and Staphylococcus epidermidis and isolates of those species that are oxacillin resistant. Each assay contains primers for a well-conserved region of the 16S rRNA gene (241bp) that serves as an internal control. S. aureus specific primers amplify a 108bp fragment and S. epidermidis specific primers amplify a 125bp fragment. PCR amplification of a 174bp fragment of the mecA gene that encodes oxacillin resistance will appear only in those strains carrying this gene.

Regarding the assay above, which of the lanes represent DNA from a strain of oxacillin resistant Staphylococcus aureus?

A) 1
B) 2
C) 3
D) 4
E) 5
F)  6
G) 7

Answer: B

 

Oxacillin is in the class of penicillin derivatives called penicillinase resistant penicillins that were first engineered in response to the development of penicillin resistance among isolates of S. aureus. Which of the following penicillin derivatives also is in this class?

A) penicillin V
B) methicillin
C) carbenicillin
D) ampicillin
E) piperacillin

Answer: B

(Year Posted:  UI 211)

 

Key Code: M

PCR reactions are conducted in an apparatus called a thermocycler that cycles the temperature between a high temperature of typically 95oC for a short time and then a lower temperature of typically 55oC for a longer time. The purpose of the high temperature step is best described by which of the following terms?

A) primer annealing
B) DNA synthesis
C) denaturation
D) primer extension
E) enzyme inactivation

Answer: C

 

According to the data presented, which of the following best describes the location of the mecA gene in resistant isolates?

A) chromosomal
B) on a plasmid
C) bacteriophage encoded
D) cannot be determined from this assay

Answer: D

The 16S rRNA-specific primers used for the PCR assay will amplify DNA from closely related species only.  Which of the following statements regarding the results seen in lanes 6 & 7 of the gel photograph is MOST ACCURATE?

A) Both represent DNA from oxacillin sensitive isolates of S. aureus
B) Neither lane could possibly represent DNA from oxacillin resistant bacteria
C) It is unlikely that the bacteria represented in these lanes is either S. aureus or S. epidermidis
D) It is likely that the bacteria represented in these lanes are from a family of Gram-negative bacilli

Answer: C

(Year Posted: UI 212)

 

Key Code: M

The attenuation system of regulation of gene expression in anabolic pathways

A) depends upon the coupling between transcription and translation
B) is common to both prokaryotes and eukaryotes
C) is repressor protein dependent
D) is an example of positive control of gene expression

Answer: A

(Year Posted:  UI 213)

 

Key Code: M

A well-experienced lab tech performing an acid-fast stain forgot to counter stain with malachite green.  The bacterial smear was thought to contain Mycobacterium kansasii. If the suspected bacteria were present in the smear which of the following best describes their appearance upon microscopic examination?

A) small, pale blue bacilli
B) small, pale blue bacilli
C) small, bright purple bacilli
D) small, green bacilli
E) colorless, they would not be seen

Answer: B

(Year Posted:UI 214)

 

Key Code: M

The detection of acid end products of  fermentation or neutral end products of fermentation is one of the tests used to differentiate among some isolates of the family Enterobacteriaceae.  Which of the following best describes the metabolic basis for these tests?

A) glucose respiration
B) pyruvate reduction
C) pyruvate oxidation
D) NAD reduction
E) gluconeogenesis

Answer: B

(Year Posted:UI 215)

 

Key Code: M

A smear taken from a  badly infected scrape on the leg of a 63-year old diabetic woman was Gram-stained and then cultured on blood agar. Both the initial Gram stain and the subsequent culture were consistent with infection by Gram-positive cocci. Which of the following tests would be the MOST logical to perform next to begin the process of species identification?

A) urease test
B) catalase test
C) coagulase test
D) oxidase test
E) agglutination test with anti-protein A antiserum

Answer: B

(Year Posted:  UI 216)

 

Key Code: M

Which one of the following would be an appropriate molecular clock for use when studying the phylogeny of BOTH bacteria and eukaryotes? Gene(s) encoding

A) chitin synthetase
B) flagellin
C) peptidoglycan crosslinking enzyme
D) RNA-dependent RNA polymerase
E) ribosomal RNA

Answer: E

(Year Posted: UI 217)

 

Key Code: M

Use the following history to answer questions

An 18-month old child was brought to the emergency room by her father. The child was running a fever and complaining that her ear hurt. Everything being consistent with otitis media, a common childhood ailment, the doctor prescribed amoxicillin and urged the father to remember to make sure that the child completed the entire prescribed 10 day regimen.  When the child felt no better within 3 days, the father returned. Suspecting that the bacteria causing the infection was resistant to amoxicillin, the doctor changed the medication to chloramphenicol. Two days later, the father returned yet again. Upon further questioning, it became clear that infections of this type had been common since the child's birth. The doctor decided to perform a needle aspiration through the tympanic membrane in order to more accurately assess what was causing the infection in  the middle ear. Bacteria isolated were a pure culture of non-typeable Hemophilus influenzae, a common Gram-negative bacteria associated with ear infections.

The isolated bacteria were tested for antibiotic sensitivity using the disk diffusion assay. In this assay, paper disks impregnated with antibiotics are placed on a lawn of bacteria. The antibiotic diffuses away from the disk. Circular zones of no growth surrounding a disk indicate a level of sensitivity to the antibiotic. The results of the sizes of the zones of inhibition around various antimicrobials were as follows:

Antimicrobial

zone (mm)

amoxicillin<1mm

ceftriaxone<1mm

chloramphenicol  1mm

kanamycin 25mm

gentamicin 18mm

doxycycline   9mm

sulfanilamide 36mm

Comparison of these results with those of known sensitive organisms suggest that kanamycin, gentamicin, or sulfa drugs should be useful in eradicating this infection.

Based only on the data above, which of the following antimicrobials has the highest likelihood of also showing potential efficacy in this case?

A) erythromycin
B) clindamycin
C) rifampin
D) neomycin
E) norfloxacin

Answer: D

 

Regarding the antibiotics tested, which of the following drug pairs target protein synthesis?

A) amoxicillin & chloramphenicol
B) amoxicillin & kanamycin
C) ceftriaxone & gentamicin
D) chloramphenicol & kanamycin
E) sulfanilamide and chloramphenicol

Answer: D

The resident on call looked at the  disk diffusion assay data and concluded that sulfanilamide would be more useful than gentamicin in this case.  Is this a valid conclusion?

A) Yes, because the bacteria were clearly much more sensitive to the sulfa drug
B) Yes, because the bacteria were clearly much more sensitive to gentamicin
C) No, because the zone of inhibition size is dependent on many variables
D) No, because the resident on call looked really sleepy

Answer: C

 

Non-typeable Hemophilus influenzae are often un-encapsulated, yet cause some of the diseases commonly associated with encapsulated organisms such as the otitis media seen here.  Assuming that some factor on the cell surface of these organisms is providing a function similar to that which a capsule often provides,  what would be the principal function of that factor with regard to virulence?

A) antiphagocytosis
B) adhesion
C) cytotoxicity
D) endotoxic effects
E) membrane disruption

Answer: A

(Year Posted:  UI 218)

 

Key Code: M

Just before you are about to inject an infant with MMR vaccine, the mother stops you and asks how you are sure that the syringe you have just unwrapped is not contaminated. You calmly explain that plastics like the syringe are sterilized after they are packaged and should remain sterile until the packaging is opened. The sterilizing agent for this kind of sterilization is:

A) flash autoclaving
B) ionizing radiation
C) ethylene oxide gas
D) UV-radiation
E) dry heat

Answer: B

(Year Posted:UI 219)

 

Key Code: M

Many antibiotics like streptomycin and tetracycline are selectively toxic because eukaryotic cells

A) have a membrane bound nucleus
B) have structurally distinct 80S ribosomes
C) contain internal compartments like endoplasmic reticulum
D) incorporate respiratory enzymes in their cell membrane
E) possess linear chromosomes

Answer: B

(Year Posted: UI 220)

 

Key Code: M

Bacteria that can utilize lactose as a carbon source typically will express the genes that specify enzymes for lactose breakdown only when lactose is present. In the absence of lactose, gene expression is generally controlled by,

A) anticodon regulators
B) preventing translation of mRNA previously transcribed
C) positive regulators that direct RNA polymerase elsewhere
D) negative regulators that block transcription
E) selective deletion of unneeded genes
F) cassette recombination to replace lac genes with others

Answer: D

(Year Posted:  UI 221)

 

Key Code: M

Bacterial cells contain a variety of structural components made up of various combinations of three major macromolecules; lipids, proteins and carbohydrates.  Which of the following cellular structures contains primarily repeating units of the same protein?

A) peptidoglycan
B) capsules
C) lipopolysaccharide
D) O antigens
E) teichoic acids
F) ribosomes
G) flagella

Answer: G

(Year Posted:UI 222)

 

Key Code: M

A culture of Group A streptococci is plated on a blood agar plate and incubated overnight. The next day, isolated colonies are surrounded by a zone in which the blood agar is clear and colorless.This is best described as

A) no hemolysis
B) a-hemolysis
C) b-hemolysis
D) c-hemolysis
E) d-hemolysis
F) e-hemolysis

Answer: C

(Year Posted:UI 223)

 

Key Code: M

All of the following bacterial cell components are typically contain saccharide units as part of their structure, EXCEPT:

A) capsules
B) peptidoglycan
C) teichoic acids
D) flagella
E) LPS

Answer: D

(Year Posted:UI 224)

 

Key Code: M

Antibiotic X was added to a liquid culture of sensitive bacteria during mid-exponential phase of growth. The optical density (turbidity) of the culture decreased rapidly following addition of the antibiotic. Which ONE of the following is a logical conclusion that one can draw from this observation?

A) Antibiotic X is bacteriostatic
B) Antibiotic X requires actively growing cells
C) The addition of antibiotic X to the culture resulted in the lysis of the cells
D) The main target of antibiotic X is an enzyme involved in cell wall synthesis
E)  Antibiotic X would be effective against intracellular pathogens

Answer: C

(Year Posted:UI 225)


 

Key Code: M

Five independent non-motile mutants of Escherichia coli were isolated. Genetic analyses included complementation tests. In the complementation tests, each mutant strain as well as the wild type strain were used as a recipient of DNA via generalized transduction from each of the other strains. The results are shown in the table below where (+) denotes motility or wild type phenotype, (-) denotes non-motility or mutant phenotype.

strainWTMut1Mut2Mut3Mut4Mut5

WT++++++

Mut1+-+++-

Mut2++-+++

Mut3+++-++

Mut4++++-+

Mut5+-+++-

Given this data, which mutant strains contain mutations in the same gene?

A) mutants 1 & 2
B) mutants 1 & 5
C) mutants 2 & 4
D) mutants 3 & 4

Answer: B

 

Generalized transduction, such as that used to obtain the data in the question above, is one way in which bacteria can introduce DNA to their cells. Which of the following is a property of generalized transduction?

A) It is sensitive to the addition of DNase in the media
B) Transducing phage particles contain phage DNA linked to bacterial DNA
C) Transducing phage particles contain only bacterial DNA
D) The donor cell that releases the generalized transducing particles must be in contact with the recipient cell that receives the particles

Answer: C

(Year Posted: UI 226)

 

Key Code: M

Which of the following antibiotic combinations is MOST LIKELY to result in antagonism when used to combat a bacterial infection? (You may assume that the organism is sensitive to each of the antibiotics.)

A) sulfanilamide & trimethoprim
B) kanamycin & gentamicin
C) chloramphenicol & tetracycline
D) ampicillin & tetracycline
E) tetracycline & erythromycin
F) chloramphenicol & erythromycin

Answer: D

(Year Posted:UI 227)

 

Key Code: M

Which one of the following is MOST likely to localize in the periplasm of Gram-negative bacteria?

A) capsules
B) lipopolysaccharide
C) ribosomes
D) phosphatases
E) teichoic acids
F) lipoteichoic acids
G) O antigens

Answer: D

(Year Posted: UI 228)

 

Key Code: M

A Gram+ organism was isolated in pure culture. A small sample of the culture was transferred to a glass slide. When a drop of hydrogen peroxide was dropped onto the slide there was an immediate and visible effervescence. This reaction is consistent with the presence of which of the following enzymes?

A) catalase
B) coagulase
C) urease
D) super oxide dismutase
E) protease

Answer: A

(Year Posted: UI 229)

 

Key Code: M

Bacterial strain differences within a species are often defined on the basis of antigenic diversity among various surface structures. Which of the following DOES NOT exhibit this kind of structural variability?

A) pili
B) peptidoglycan
C) O antigens
D) capsules
E) flagella

Answer: B

(Year Posted: UI 230)

 

Key Code: M

Use the answer choices below to answer questions

Choose the one BEST answer that could account for the described events

A) conjugation
B) recombination
C) replication
D) transcription
E) transduction
F) transformation
G) translation
H) transposition

__E__    A strain of Vibrio cholerae acquires the ability to produce a new cytotoxin along with cholera toxin after exposure to a lysogenic bacteriophage

__D_     Mycobacterium tuberculosis growing in alveolar macrophages is exposed to rifampin and this process is immediately affected

__H_     A conjugative R plasmid encoding tetracycline and ampicillin resistance enters a cell encoding neomycin resistance. Upon subsequent conjugative transfer all three resistances are transferred at the same time as part of the same plasmid

__A_     A strain of Pseudomonas aeruginosa begins producing a b-lactamase similar to that encoded by a strain of Salmonella enteritidis

__B_     Chromosomal genes transferred from a closely related bacteria are stably inherited by succeeding generations

__F_     An unencapsulated strain of Neisseria meningitidis acquires the ability to make a capsule after exposure to an extract containing DNA from an encapsulated strain of the same species


(Year Posted:UI 231)

 

Key Code: M

Refer to the diagram below to answer questions

 

Regarding the structures shown, which would stably transfer chromosomal DNA to a recipient cell at the highest frequency?

A) F+
B) Hfr
C) F'

Answer: C

Regarding the structures shown, which would stably transfer chromosomal DNA only to a recipient cell with a functioning recombination system?

A) F+
B) Hfr
C) F'

Answer: B

The formation of F' plasmids most closely resembles which of the following?

A) formation of specialized transducing phage
B) induction of the lactose operon
C) reception of chromosomal DNA from generalized transducing phage
D) transposon integration into the host chromosome

Answer: A

(Year Posted: UI 232)

 

Key Code: M

The most important function of the peptidoglycan layer of the bacterial cell wall is to

A) provide a framework for the overall shape of the cell
B) serve as a location for proteins involved in  membrane transport
C) serve as the site for electron transport
D) prevent osmotic lysis of the cell
E) furnish sites for the covalent binding of flagellar proteins to the cell surface

Answer: D

(Year Posted:UI 233)

 

Key Code: M

Sulfa drugs and trimethoprim are often used in combination. The best explanation for their combined use is to

A) take advantage of a synergistic effect
B) increase the range of bacteria affected by either drug alone
C) prevent the emergence of bacteria resistant to either drug
D) increase the adsorption of sulfa drugs
E) limit the side effects of trimethoprim use

Answer: A

(Year Posted: UI 234)

 

Key Code: M

A bacterial culture is plated on MacConkey plates. After overnight incubation all of the colonies that have arisen are dark pink in color. Which of the following is MOST ACCURATE with regard to these colonies?

A) Lactose fermenting, Gram+ cocci have grown
B) increase the range of bacteria affected by either drug alone
C) prevent the emergence of bacteria resistant to either drug
D) increase the adsorption of sulfa drugs
E) limit the side effects of trimethoprim use

Answer: B

(Year Posted:UI 235)

 

Key Code: M

Plasmids are very important in the spread of antibiotic resistance because

A) they can replicate in the absence of bacteria
B) they can evolve more rapidly than chromosomes
C) antibiotics induce mutations in plasmids
D) they often code for penicillin
E) they can transfer rapidly among a variety of bacteria

Answer: E

(Year Posted: UI 236)

 

Key Code: M

Consider the following diagram to answer questions

 

What is the MIC for the antibiotic being tested?

A) 0 mg/ml
B) 2 mg/ml
C) 4 mg/ml
D) 8 mg/ml
E) 16 mg/ml

Answer: D

Referring to the diagram in the previous question, which of the following most accurately describes how one would determine the MBC?

A) Add additional antimicrobials to each culture in serial dilution
B) Perform Gram stains on samples from several tubes
C) Plate samples from each tube onto agar plates
D) Incubate each tube for an additional 24 hours
E) Isolate DNA from each tube

Answer: C

 

Which of the following statements about MIC measurements as depicted above is the MOST ACCURATE?

A) The MIC of both bactericidal and bacteriostatic antimicrobials can be obtained by this method
B) This method can be used only to measure the MIC of bactericidal drugs
C) The lack of turbidity in some tubes in directly related to lysis of cells
D) The dilution of the bacteria culture at the beginning of the procedure is a series of 1 to 2 dilutions

Answer: A

(Year Posted: UI 237)

 

Key Code: M

The following answer choices are to be used for questions

A) rifampin
B) norfloxacin
C) streptomycin
D) penicillin
E) piperacillin
F) trimethoprim
G) isoniazid
H) clindamycin
I)  erythromycin
J)  vancomycin

__D__   A 6 year old child visits his pediatrician with sore throat and low grade fever. A throat swab followed by a Rapid-Strep test is positive for Group A strep (Streptococcus pyogenes). The child has no allergies and the doctor prescribes this antibiotic to which these bacteria have never shown resistance

__A_    After routine screening for tuberculosis using ppd skin testing, a 23-year old college student tested TB+. A subsequent chest x-ray showed evidence of productive infection. Among the multiple antibiotics prescribed to combat this infection was this inhibitor of bacterial RNA polymerase

__G_    A health care worker tests ppd-positive during routine screening. A similar skin test one year earlier was not positive. There is not other evidence of active tuberculosis disease. Her doctor prescribes this single drug as a prophylactic measure to prevent the development of active TB

__I_    A 67-year old man with a history of cigarette smoking is diagnosed with Legionnaire's disease. After a 2 week course of therapy with this antibiotic he recovers. This macrolide is the drug of choice for this disease and works by inhibiting the elongation phase of protein synthesis

__J_    An 83-year old woman was hospitalized following an accident causing her multiple injuries. The severity of her injuries necessitated putting her on a respirator to aid her breathing. After 5 days, she developed a bacterial pneumonia. Staphylococcus aureus was identified as the cause and drug susceptibility testing revealed that the isolate was resistant to virtually all b-lactam drugs. She was immediately prescribed this alternative cell wall synthesis inhibitor that is administered intravenously and usually held in reserve for treatment of infections such as this one

__E_    A 4 year old child with a family history of cystic fibrosis presents with bacterial pneumonia. Culture confirmation identifies Pseudomonas aeruginosa infection. This extended spectrum b-lactam drug was developed specifically for its utility in cases such as this

__B_    A 66-year old woman underwent triple heart bypass surgery. The insertion of a urinary catheter, routine in similar situations, led to the development of a urinary tract infection. Lab tests identified Pseudomonas aeruginosa infection. The drug prescribed for her inhibits DNA gyrase

__H_    Following extended use of an oral preparation of this antibiotic that is a protein synthesis inhibitor. A 57-year old man developed pseudomembranous enterocolitis, also known as antibiotic-associated enterocolitis, which is a result of the outgrowth of Clostridium difficile that are resistant to the antibiotic. Following removal of the antibiotic and treatment with oral vancomycin he recovered nicely


(Year Posted:UI 238)

 

Key Code: M

Refer to the diagram below to answer questions

The structure below represents the basic structure of a common group of antibiotics:

 

Which of the arrows points to the cleavage site of b-lactamase?

A) arrow A
B) arrow B
C) arrow C
D) arrow D
E) arrow E

Answer: B

Cephalosporins differ from the molecule depicted above in that they

A) have a six-membered sulfur containing ring
B) have a six-membered ring containing no sulfur
C) contain no nitrogen molecules
D) have a totally different mechanism of action
E) contain a b-lactam ring, but not other ring structures

Answer: A

Which of the following statements concerning the activity of this group of antimicrobials is MOST ACCURATE?

A) The development of resistance to the group is rare
B) The compounds are non-allergenic
C) To be effective, bacteria targeted must be actively growing
D) This group of antimicrobials exhibits poor selective toxicity

Answer: C

 

Research that has led to different derivatives by substitution for different R groups at sites indicated on the diagram has mostly been driven to find derivatives that

A) are more stable
B) are more effective against Gram-negative bacteria
C) are more effective against Gram-positive bacteria
D) are cheaper to manufacture

Answer: B

(Year Posted: UI 239)

 

Key Code: M

Refer to the plasmid diagram below to answer questions

 

Which of the sites labeled on this plasmid map is required for its independent replication inside bacterial cells?

A) ampR
B) tetR
C) rop
D) ori
E) EFF

Answer: D

EcoRI, HindIII and BamHI are restriction enzymes with cutting sites on this plasmid at the positions indicated in the diagram. BamHI would be superior for DNA cloning compared to EcoRI and HindIII because it differs from the other two in that it

A) cuts at only one position in the plasmid
B) is closest to the ori region
C) cuts within the tetR gene
D) is most economical
E)  leaves the ampR gene intact
F)  cuts within a DNA sequence that is described as a reverse palindrome

Answer: C

(Year Posted: UI 240)

 

Key Code: M

Cloning of eukaryotic DNA into this plasmid that you want to express in E. coli would most likely

A) require the construction of eukaryotic genomic DNA library
B) require that you construct a DNA library in yeast cells first
C) begin with isolation of eukaryotic nuclear DNA
D) begin with isolation of mRNA from eukaryotic cells

Answer: D

Cloning of DNA into this vector would require which of the following proteins to seal the single strand gaps at the site of DNA insertion in the vector plasmid?

A) reverse transcriptase
B) DNA gyrase
C) DNA polymerase
D) RNA polymerase
E)  ligase
F)  single-stranded DNA binding protein
G)  restriction enzyme

Answer: E

The ampR and/or tetR regions of the plasmid are very important for DNA cloning because they

A) facilitate the conjugative  transfer of plasmid to recipient cells
B) are selectable genes that allow the identification of recipient cells
C) are required for the replication of the plasmid in recipient cells
D) are necessary for the insertion of insert DNA
E)  allow the plasmid to exist in multiple copies inside recipient cells

Answer: B

(Year Posted:UI 241)

 

Key Code: M

Bacterial cells most commonly control gene expression by means of

A) an addition mutation within a gene
B) triplets of nucleotides
C) preventing translation of mRNA previously produced by RNA polymerase
D) transcription control, often via repressor proteins that block transcription
E) deletion of unneeded genes

Answer: D

(Year Posted: UI 242)

 

Key Code: M

Several people attending a company picnic came down with severe gastroenteritis 2-3 days later. Leftover foods were tested and a strain of Salmonella typhimurium was isolated in large numbers from an egg salad. The strain of bacteria was tested for resistance to a variety of antibiotics and was found to be tetracycline resistant. Further analysis suggested that resistance was due to the presence of an efflux pump that pumps tetracycline out of cells as it enters. Further experimentation would also likely demonstrate

A) efflux pumps for a variety of other drugs
B) the presence of a plasmid encoding the efflux pump
C) a cell exterior that prevents tetracycline entrance
D) an inability to detect plasmid DNA
E) lysogenic conversion of the bacterial strain

Answer: B

(Year Posted: UI 243)

 

Key Code: M

Refer to the diagram below to answer questions

 

Data for the diauxic growth curve above was obtained by growing a culture of E. coli in the presence of both glucose and lactose. The cAMP concentration in cells is high when the glucose concentration is low.  In which part of the growth curve would you expect the cAMP concentration to be the highest?

A) A & B
B) C & D
C) A & D
D) B & D

Answer: B

In which part of the curve is the lactose concentration the highest?

A) A & B
B) C & D
C) A & D
D) B & D

Answer: A

Transcription of the lac operon would reach maximal levels in which part of the growth curve?

A) A
B) B
C) C
D) D

Answer: D

(Year Posted:UI 244)

 

Key Code: M

The following answer choices are to be used for questions

A) autoclaving
B) halogens
C) ionizing radiation
D) cationic detergents
E) phenol
F) filtration
G) ethylene oxide
H) triclosan
I)  formaldehyde

__B__  inactivates enzymes by reaction with sulfhydryl groups

__A_    preferred method of sterilization when possible

__C_    common sterilization method for prepackaged plastics

__F_    standard reaction to this chemical is used as a basis for disinfectant standardization

__E_    hydrophilic portion interacts with the cell surface, hydrophobic portion with the membrane interior

__I_     has been incorporated into plastic to manufacture bacterial resistant toys

__H_    in gaseous form, a common sterilization procedure


(Year Posted: 2001 UI 245)

 

Key Code: M

Bacteria that become streptomycin resistant due to a chromosomal mutation are often still sensitive to drugs like kanamycin and gentamicin. This is most likely because these drugs

A) affect a different metabolic pathway
B) are of a different antimicrobial class
C) are not affected by enzymes that modify streptomycin
D) bind to additional sites on the bacterial ribosome
E) more easily cross the cell membrane

Answer: D

(Year Posted: UI 246)

 

Key Code: M

Bacteria resistant to rifampin are isolated after incubating agar plates with rifampin incorporated into the media. The culture plated on the media was a pure culture and no rifampin resistant cells had previously been selected. Which of the following most accurately describes the rifampin resistant bacteria that were isolated?

A) Mutants with a target site alteration mutation
B) Mutants constitutively expressing an efflux pump
C) Plasmid recipients expressing rifampin inactivating enzymes
D) Plasmid recipients expressing a gene for a target site alteration

Answer: A

(Year Posted: UI 247)

 

Key Code: I

Three days after an appendectomy, the patient develops high fever. The patient's vital signs include a fast weak pulse, rapid and shallow respiration, and dangerously low blood pressure. The patient's erythrocyte sedimentation rate (ESR) is very high. The incision site is tender, red, and edematous. What cytokine is most likely responsible for all these symptoms?

A) IL-4
B) IFN-g
C) IL-8
D) TNF-a
E) IL-10

Answer: D

(Year Posted:UI 248)

 

Key Code: I

A 26-year-old male, with significant cat allergies, visits a home with multiple cats. Two hours later, he arrives at an urgent care center with a severe exacerbation of asthma. He is treated with a short acting bronchodilator and epinephrine. Initially, after treatment, his symptoms resolved; however, 8 hours later he is forced to go to the emergency room with another exacerbation. What is the MOST LIKELY cause of his symptoms?

A) Additional IgE cross-linking on mast cells leading to lipid mediator and cytokine release
B)  CD4+TH1 cells production of IFN-g
C) Complement activation leading to mast cell degranulation by C5a and C3a
D) Eosinophil and basophil infiltration leading to the release of proinflammatory mediators
E) Macrophage chemotaxis and the release of superoxide radicals

Answer: D

(Year Posted:UI 249)

 

Key Code: I

An individual with a defect in CTLA-4 will be most likely to have which of the following?

A) Type I hypersensitivity
B)  immunodeficiency
C) recurrent Neisseria infections
D) lymphoproliferative diseas

Answer: D

(Year Posted:UI 250)

Key Code: I

The class of immunity generated against a particular pathogen is determined by the cytokines present in the environment. Which of the following combinations of cytokines will lead to a response that is appropriate against a virus infection?

A) IL-4, IL-10, and IFNg
B) IL-12 and IFNg
C) IL-2, and TGFb
D) IL-4, IL-5, and IL-10

Answer: B

(Year Posted:UI 251)

 

Key Code: I

Once a TH1 or TH2 response has been generated, it is perpetuated by cytokines that down regulate the opposing response. If a humoral response has been stimulated, which cytokines will maintain that response?

A) IL-4 and IL-10
B) IL-4 and IL-12
C) IL-4 and TNFb
D) IL-1 and IL-6

Answer: A

(Year Posted: UI 252)

 

Key Code: I

The most likely reason for a lung allograft to undergo immune mediated rejection at three weeks post transplantation is

A) activation of cytotoxic T lymphocytes
B) destruction by preformed antibodies
C) immune complex mediated tissue damage and  buildup of inflammatory lesions
D) an ABO mismatch

Answer: A

(Year Posted:UI 253)

 

Key Code: I

One of the most important cytokines in the non-specific activation of macrophages as effector cells of delayed-type hypersensitivity is

A) IL-4
B) IFNg
C) TNFa
D) IL-8
E) IL-2

Answer: B

(Year Posted:UI 254)

 

Key Code: I

Gene rearrangement leads to the development of antigen specific receptors on which of the following cells?

A) NK cells, ADCC, and CTL
B) B cells, CTL and natural killer cells
C) CTL, DTH and helper T cells
D) B cells, CTL and helper T cells
E) B cells and Macrophages

Answer: D

(Year Posted: UI 255)

 

Key Code: I

Bob is allergic to ragweed pollen. He has been treated with ragweed pollen allergen using a minute concentration and gradually increasing doses repeatedly for desensitization (hyposensitization) therapy to reduce the allergic reaction. Hyposensitization probably operates using which of the following principles?

A) clearance of antigen-specific IgE immune complexes
B) greater production of circulating high affinity IgG antibody
C) depletion of the mast cell pool by repeated degranulation
D) specific tolerance induction

Answer: B

(Year Posted:UI 256)

 

Key Code: I

These results were seen in a Mixed Lymphocyte Culture:

Cells

counts per minute

A + irradiated B

15,000

A alone

  2,000

They indicate that

A) A and B share all Class I MHC alleles
B) A and B share all Class II MHC alleles
C) A and B have at least some differences in Class II MHC alleles causing B to proliferate
D) A and B have at least some differences in ClassII MHC alleles causing A to proliferate

Answer: D

(Year Posted:UI 257)

 

Key Code: I

What cells do not participate in granuloma formation?

A) B cells
B) Macrophages
C) Histiocytes
D) Multinuleate giant cells
E) T cells

Answer: A

(Year Posted:UI 258)

 

Key Code: I

TAP-1 and TAP-2 proteins are involved in:

A) MLR reactions
B) antibody production
C) the classical complement pathway
D) transport of peptides into the RER where they are captured by Class I MHC
E) transport of peptides into the RER where they are captured by Class II MHC

Answer: D

(Year Posted:UI 259)

 

Key Code: I

Complement plays a role in all of the following except?

A) Opsonization
B) clearance of Immune Complexes
C) antibody dependent cell cytotoxicity (ADCC)
D) cytolysis
E)  inflammation

Answer: C

(Year Posted:UI 260)

 

Key Code: I

A deficiency in which component of complement inhibits both the lectin and classical pathways but not the alternative pathway

A) C1
B) C5
C) C3
D) C4
E) C9

Answer: D

(Year Posted: UI 261)

 

Key Code: I

Use the following options to answer questions:

A) Paroxysmal Nocturnal Hemoblobinuria
B) Systemic Lupus Erythematosus (SLE)
C) Hereditary Angioneurotic Edema (HANE)
D) Leukocyte Adhesion Deficiency (LAD-1)
E) Neisseria Infections
F) Common Variable Immunodeficiency
G) Chronic Granulomatous Disease

__B_    This disease is sometimes associated with deficiencies in C1, C2, C4 or CR1

__A_    This disease results from the absence of decay accelerating factor and homologous restriction
              factor

__E_    Patients with a deficiency in components of the membrane attack complex (MAC) are
             susceptible to developing this


(Year Posted: UI 262)

 

Key Code: I

Which of the following is not a professional antigen presenting cell?

A) Dendritic cell
B) B cell
C) Macrophage
D) Endothelial cell

Answer: D

(Year Posted: UI 263)

 

Key Code: I

One of the roles of invariant chain is

A) to transport peptides into the endoplasmic reticulum for binding to MHC class I
B) to transport peptides into the endoplasmic reticulum for binding to MHC class II
C) to interact with the groove of MHC class II in the endoplasmic reticulum to prevent binding of endogenous peptides
D) to facilitate the cleaving of peptides that have been ubiquinated
E) to promote the folding of MHC class I

Answer: C

(Year Posted: UI 264)

 

Key Code: I

H-2k mice were infected with lymphocytic choriomeningitis (LCM) virus to induce cytotoxic, CD8+ T cells specific for this virus. Spleen cells (containing cytotoxic T cells) from this LCM primed mouse were added to target cells of different H-2 haplotypes. CTL mediated killing was only observed with

A) LCM infected H-2k target cells
B) LCM infected H-2b target cells
C) Herpes zoster infected H-2k target cells
D) Herpes zoster infected H-2b target cells
E) Uninfected H-2k target cells

Answer: A

(Year Posted:  UI 265)

 

Key Code: I

Which immunoassay would most likely be used to determine the percent B cells in a   peripheral blood lymphocyte sample from a patient

A)  ELISA
B)  Western Blot
C)  Flow cytometry
D) Immunofluorescent staining
E) Radioimmunoassay

Answer: C

(Year Posted: UI 266)

 

Key Code: I

The T cell receptor (TCR) is to CD3 as B cell surface immunoglobulin  (Ig) is to

A) Iga/b
B) CD19
C) B7
D) D21
E) CD40

Answer: A

(Year Posted:UI  267)

 

Key Code: I

Cyclosporin and FK506 block B and T cell activation by targeting

A) CD45
B) Calcineurin
C) Lyn kinase
D) ZAP-70
E) Protein kinase C

Answer: B

(Year Posted:UI  268)

 

Key Code: I

T cell activation requires the following

A) recognition of peptide in the context of MHC only
B) recognition of peptide in the context of MHC plus CD40-CD40L interactions
C) CD40-CD40L interactions only
D) B7-CD28 interactions only
E) recognition of peptide in the context of MHC plus B7-CD28 interactions

Answer: E

(Year Posted: UI  269)

 

Key Code: I

The following factor or factors can lead to mast cell degranulation

A) crosslinkage of FceRI on mast cells
B) binding of C3a and C5a to receptors on mast cells
C) A and B
D) crosslinkage of FcgRII on mast cells
E) B and D

Answer: C

(Year Posted: UI  270)

 

Key Code: I

The late response in an asthma attack involves the release of all of the following except

A) IL-4, IL5 and IL6
B) TNF-a
C) IL-13
D) eosinophil chemotactic factor (ECF) and platelet activating factor (PAF)
E) histamine

Answer: E

(Year Posted:UI  271)

 

Key Code: I

A medical resident at a hospital was accidentally stuck with a hypodermic needle. She was immediately given Hepatitis B immune globulin (HBIG) for precautionary measures. Six hours later she developed fever, urticaria, edema and joint pains. The most likely cause of her symptoms is

A) anaphylaxis
B) serum sickness
C) delayed type hypersensitivity (DTH)
D) secondary immune response to Hepatitis B
E) antibody dependent cell cytotoxicity (ADCC)

Answer: B

(Year Posted:UI  272)

 

Key Code: I

T cells that exit the thymus have the following characteristics

A) CD4+CD8+, express the TCR and have high affinity for self antigen plus MHC
B) CD4-CD8-, express the TCR and have high affinity for self antigen plus MHC
C) CD4+ or CD8+, don't express the TCR and have low affinity for self antigen plus MHC
D) CD4+ or CD8+ express the TCR and have high affinity for self antigen plus MHC
E) CD4+ or CD8+ express the TCR and have low to moderate affinity for self antigen plus MHC

Answer: E

(Year Posted:  UI  273)

 

Key Code: I

Which of the following mechanisms described below does not lead to immunologic tolerance

A) lack of co-stimulation of B and/or T cells
B) Fas-Fas ligand interactions on B and /or T cells
C) exposure of immature B and T cells to foreign antigen
D) exposure to foreign antigen that crossreacts with self antigen

Answer: D

(Year Posted:UI  274)

 

Key Code: I

The germinal centers found in the cortical region of lymph nodes and the peripheral region of splenic periarteriolar lymphatic tissue

A) support the development of immature B and T cells
B) function in the removal of damaged erythrocytes from the circulation
C) act as the major source of stem cells and thus help to maintain hematopoiesis
D) provide an infrastructure that on antigenic stimulation contains large populations of B lymphocytes and plasma cells
E) are the sites of NK-cell differentiation

Answer: D

(Year Posted:UI  275)

Key Code: I

A 50-year-old worker at an atomic plant who previously had a sample of his own bone marrow cryopreserved was accidentally exposed to a minimal lethal dose of radiation. He was subsequently transplanted with his own bone marrow. This individual can expect

A) to have recurrent bacterial infections
B) to have serious fungal infections due to deficiency in cell-mediated immunity
C) to make antibody responses to thymus-independent antigens only
D) all of the above
E) none of the above

Answer: E

(Year Posted: UI  276)

 

Key Code: I

Serologic testing before kidney transplantation reveals that the leukocytes of a prospective recipient are killed by the following anti-HLA antibodies in the presence of complement: anti-B27, anti-A1, and anti-A3. You can conclude

A) that the prospective recipient expresses the B27, A1, and A3 HLA specificities
B) that the prospective recipient does not express the B27, A1, and A3 HLA specificities
C) that the potential donor and the prospective recipient are not siblings
D) that the potential donor and the prospective recipient are not identical twins
E) that the prospective recipient should not receive a kidney graft that expresses these HLA specificities

Answer: A

(Year Posted: 2001 UI  277)

 

Key Code: I

Anaphylaxis may be triggered in atopic individuals by

A) first time exposure to a particular antigen
B) binding of hapten to an IgE coated mast cell
C) cross-linking of IgG on the surface of B cells and macrophages
D) binding of a multivalent allergen to IgE coated mast cell
E) elevated titers of circulating immune complexes

Answer: D

(Year Posted:UI  278)

 

Key Code: I

Positive selection of ab T cells requires

A) MHC class I or class II restriction of T cells in the thymus
B) presence of CD4 and CD8 accessory molecules on the surface of T cells
C) a and b
D) high avidity interaction of TCR with peptide and MHC
E) that T cells are in the double negative stage (CD4-CD8-) of development

Answer: C

(Year Posted:UI  279)

 

Key Code: I

All of the following cells play major roles in a DTH response except

A) TH2 CD4 T cells
B) CD8 T cells
C) macrophages
D) TH1 CD4 T cells

Answer: A

(Year Posted:UI  280)

 

Key Code: I

In which of these processes does DNA double-strand break repair occur?

A) class switching and differential splicing
B) class switching and somatic hypermutation
C) VDJ recombination and class switching
D) VDJ recombination and differential splicing
E) VDJ recombination and somatic hypermutation

Answer: C

(Year Posted:UI  281)

 

Key Code: I

The administration of vaccines is not without hazard. Of the following, which is least likely to affect adversely an immunocompromised host?

A) measles vaccine
B) pneumococcal vaccine
C) bacille Calmette-Guerin
D) mumps vaccine
E) Sabin poliomyelitis vaccine

Answer: B

(Year Posted:UI  282)

 

Key Code: I

Active, durable immunization against poliomyelitis can be accomplished by oral  administration of attenuated vaccine (Sabin) or by parenteral injection of inactivated (Salk) vaccine. These vaccines are equally effective in preventing disease because

A) both induce adequate IgA at the intestinal mucosa, the site of entry of the virus
B) antibody in the serum protects against the viremia that leads to disease
C) viral antigen attaches to the anterior horn cells in the spinal cord, preventing attachment of virulent virus
D) both vaccines induce formation of interferon
E) both vaccines establish a mild infection that can lead to formation of antibody

Answer: B

(Year Posted: UI  283)

 

Key Code: I

The best way to provide immunologic protection against tetanus neonatorum (of the newborn) is to

A) inject the infant with human tetanus antitoxin
B) inject the newborn with tetanus toxoid
C) inject the mother with toxoid within 72 hours of the birth of her child
D) immunize the mother with tetanus toxoid before or early in pregnancy
E) give the child antitoxin and toxoid for both passive and active immunization

Answer: D

(Year Posted: 2001 UI  284)

 

Key Code: I

CD4

A) binds directly to peptide antigen
B) binds to an invariant portion of MHC class I molecules
C) binds to an invariant portion of MHC class II molecules
D) binds to CD8 on the T cell surface
E) binds to the peptide-binding site of MHC class II

Answer: C

(Year Posted:UI  285)

 

Key Code: I

MHC class I molecules are important for which of the following?

A) binding to CD8 molecules on T cells
B) presenting exogenous antigen (e.g.,bacterial protein) to B cells
C) presenting viral protein to antigen-presenting cells such as macrophages
D) binding to CD4 molecules on T cells
E) binding to Ig on B cells

Answer: A

(Year Posted:UI  286)

 

Key Code: I

Papain digestion of an IgG preparation of antibody specific for the antigen hen egg albumin (HEA) will

A) lose its antigen specificity
B) precipitate with HEA
C) lose all interchain disulfide bonds
D) produce two Fab molecules and one Fc fragment
E) none of the above

Answer: D

(Year Posted:UI  287)

 

Key Code: I

The primary and secondary antibody responses differ in

A) the predominant isotype generated
B) the number of lymphocytes responding to antigen
C) the speed at which antibodies appear in the serum
D) the biologic functions manifested by the Ig isotypes produced
E) all of the above

Answer: E

(Year Posted:UI  288)

 

Key Code: I

The ability of a single B cell to express both IgM and IgD molecules on its surface at the same time is made possible by

A) allelic exclusion
B) isotype switching
C) simultaneous recognition of two distinct antigens
D) selective RNA splicing
E) use of genes from both parental chromosomes

Answer: D

(Year Posted:UI  289)

 

Key Code: I

An antibody made against the antigen tetanus toxoid (TT) reacts with it even when the TT is denatured by disrupting all disulfide bonds. Another antibody against TT fails to react when the TT is similarly denatured. The most likely explanation can be stated as follows

A) the first antibody is specific for several epitopes expressed by TT
B) the first antibody is specific for the primary amino acid sequence of TT, whereas the second is specific for conformational determinants
C) the second antibody is specific for disulfide bonds
D) the first antibody has a higher affinity for TT

Answer: B

(Year Posted:UI  290)

 

Key Code: I

Haptens

A) require carrier molecules to be immunogenic
B) interact with specific antibody even if the hapten is monovalent
C) cannot stimulate secondary antibody responses without carriers
D) all of the above

Answer: D

(Year Posted:UI  291)

 

Key Code: I

Removal of the bursa of Fabricius from a chicken results in

A) a markedly decreased number of circulating T lymphocytes
B) anemia
C) delayed rejection of skin graft
D) low serum levels of antibodies in serum
E) all of the above
F) none of the above

Answer: D

(Year Posted: UI  292)

 

Key Code: I

Which of the following plays a role in changing the antigen binding site of a B cell after antigenic stimulation?

A) junctional diversity
B) combinatoria diversity
C) germ-line diversity
D) somatic hypermutation
E) differential splicing of primary RNA transcripts

Answer: D

(Year Posted:UI  293)

 

Key Code: I

A functional VDJ is derived from

A) gene rearrangements on the chromosome encoding Ig heavy chain constant region genes
B) gene rearrangements on the chromosome encoding the light chain genes
C) random selection of multiple Ig genes following the release of B cells from the bone marrow
D) gene rearrangement on the chromosome encoding both heavy and light chain genes
E) gene rearrangement which occurs during class switching

Answer: A

(Year Posted: UI  294)

 

Key Code: I

A lack of germinal centers in the lymph nodes, appendix, and spleen may indicate

A) a deficient B cell system
B) an acute dietary deficiency
C) a defient cell- mediated immune system
D) an elderly patient
E) a deficient T cell system

Answer: A

(Year Posted: UI  295)

 

Key Code: I

A patient suffering from melanoma is treated with a cocktail of cytokines which includes IL-2 and Interferon-gamma, among others, and begins to show improvement. Tests using his peripheral blood cells indicate that macrophage function, as measured by phagocytic activity using Ab-opsonized bacteria, has increased significantly. What could account for this effect?

A) increased adhesion molecule expression by macrophages
B) increased Fc receptor expression by macrophages
C) increased antibody production against melanoma-specific antigens
D) increased IL-1 production
E) increased macrophage size

Answer: B

(Year Posted:UI  296)

 

Key Code: I

Bruton-type agammaglobulinemia is a disease in which

A) a failure of development of the thymus is noted
B) a failure of development of the B cell system occurs
C) severe lymphopenia occurs
D) monocytes do not present antigen to the lymphoid system properly

Answer: B

(Year Posted:UI  297)

 

Key Code: I

Positive skin tests showing delayed-type hypersensitivity, such as for mumps ortuberculosis, indicate that

A) a humoral immune response has occurred
B) a cell-mediated immune response has occurred
C) both the T-cell and B-cell systems are functional
D) only the B-cell system is functional
E) the patient has an immune deficiency

Answer: B

(Year Posted: UI  298)

 

Key Code: I

Idiotypic determinants of immunoglobulin molecules (the CDR’s) are associated with

A) the Fc portion
B) constant regions of both H and L chains
C) hypervariable regions of L chain only
D) hypervariable regions of H. chain and Fc portion
E) hypervariable regions of both H and L chains

Answer: E

(Year Posted:UI  299)

 

Key Code: I

Which of the following signal transduction mechanisms is associated with T cell activation and has been shown to be inhibited by immunosuppressive agents such as cyclosporin A?

A) activation of protein tryrosine kinases
B) activation of transcription factors (e.g. NF-kB, NFAT)s
C) activation of PLC-gl
D) calcium mobilization

Answer: B

(Year Posted:UI  300)